Minutes, 6 February 1994
Recorded by Chris Exner

---------------------------------------------------

Meeting opens with noted presence of the U.C. Infiltration SIGlet.

The Masquerade will be Friday, Feb. 18.  Posters manifest in HRSFA office 
2/7.  Music is being handled by Carl Anderson and Elena O'Malley.  The skit 
is the fault of Matt D., Amanda, and others.  Bug them.

Arisia happened, and there is a small amount of pandemonium as 'cons 
are discussed.

There will be a sci-fi movie marathon on President's Day Weekend.  
M. Duhan offers to smuggle people to this.

They Might Be Giants is coming to Harvard on April 28.  A sub-committee 
is appointed to study the possibility of establishing a panel to appoint an 
independent counsel to study the possibility of HRSFA giving them 
some kind of award.

SIG Reports:

	- Writer's SIG will restart on Thursday nights.
	- The Gameathon was described as "a debacle" but there was 
	  live-action Clue.
	- BearMeatWorld did the old "elf-in-a-microwave" thing.
	- GURPS Illuminati had guest players revealing the awful 
	  truth about Disneyland.
	- Ars Magica made a foray into Bear Meat. . ..

Nominations (elections to be 2/20):

Co-Chairs:       Darcy Gibbons, Clare Sammells, Chris Hernandez, Matt Duhan, 
		 Al Elia, Chris Exner
Treasurer:       Megan McCallion (despite possible necessity of forming 
		 a Dredging SIG), Amanda Weinstein, Lory Rodruigez
Editor in Chief: Lory R., Charles Keckler, Mike Simson, Christella Wong
Infernal Secretary: Cyrus Mody, Chris E., Mike S.
External Secretary: Matt Duhan, Daryl Michaud, Lory R., Al E., Alden Strock, 
		    Chris H.

And for other Random Positions:

The Number Eight: Chris H.
Cutest Couple: S & A, C & C, L & M
Scapegoat: Tox Donehue
HAP3 (partial sequence) AAGGGTTAACGACTCGCTTACCCGTCGACATCTGTT
	(hey, it's in my notes so it MUST have happened at the meeting)

If any names are misspelled, complaints are referred to the wisdom 
of the meeting:

					"It's not my fault!"


						Chris Exner
						Infernal Secretary